Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.10 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -7.52 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: tgggtggtaccgcg is shown in italic-bold style

agacgatgataaggaaaagtagtatatactataatccaaagcgagtcagggacggtgagagcctgatgaggcggtatatgtgaagaacaccttggagttg
ctaaccgaaattgaatcttgtattcaagagtagacttagacgggaatccggcctgttacaaaccgggaagtatgtattacatacgagttaaagttggtct
ttatgacaaattgggtggtaccgcgaagtttaacctttcgtccctttatggatgaaaggtttttttgtatttaaatatatcagcaaaggagaacttcact
ATG

    asnS


Gene: asnS     GI: 47530098     BI number: GBAA4802     GOG: COG0017     Description: asparaginyl-tRNA synthetas


  t
t  a
t  t
 cg
 ta
 gc
g  a
t  a
t  a
g  |       cg
a  |      g  a
a  |      c  a
a  |       cg
t  |       at
t  |      t  t       tt
g  |      g  t      t  a
 at       g  a      c  t
 gt        ta        cg
 cg        gc        cg
a  g       gc        ta
t  |       gt        gt
a  |      t  t       cg
 cg       t  t       ta
 at       a  c       ta
 tg       a  |       ta
 tg       a  |       cg
 at        cg        cg
 ta        at        at
 gc        gc        at
                        tttttgtatttaaatatatcagcaaaggagaacttcactATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0017 Aspartyl/asparaginyl-tRNA synthetases ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here

    ..................................................................................................................