                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.70 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -6.90 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-11.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

gaagtatattatattaaaagttaaataacgaaaaacgttgatagagaagagtagcttacaaaatcgccatatagggagagaatgccttagactgaaagca
ttcttatggtagacggaagtgaattcacctctggagttgacgccaggaccatgtatatgtaaaggcgttccggtcagaattgatcgttataactaatgag
tgggcagacatgttctgtcaatttagggtggtaccgcgaatttacctcgtccctttttgggagcgaggtttttttatttttaaaattaggagggttccaa
ATG

    pheS --- pheT Gene: pheS     GI: 47530100     BI number: GBAA4804     GOG: COG0016     Description: phenylalanyl-tRNA synthetase, alpha subunit Gene: pheT     GI: 47530099     BI number: GBAA4803     GOG: COG0072,COG0073     Description: phenylalanyl-tRNA synthetase, beta subuni   t a  g c  t at gc at cg gt gc g  a ta         g gt       c  a at       g  a gt       c  t        t ta       c  t      t  t a  g       at       t  t a  |       ta        cg tg        gc        cg cg        gc        cg at       |  t       ta a  g      |  c      |  g tg       |  g       gc at       t  t       cg ta        gc        ta t  c       gc        cg gc        gc        cg cg        at        at                         ttttttatttttaaaattaggagggttccaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0016 Phenylalanyl-tRNA synthetase alpha subunit ... can be seen here [J] COG0072 Phenylalanyl-tRNA synthetase beta subunit ... can be seen here [R] COG0073 EMAP domain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................