                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:128 nt.    Distance to gene:90 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-14.10 kcal/mol
Antiterminator:    Distance from promoter:101 nt. Size=32 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:    Distance from promoter:58 nt.    Size=46 nt.     Delta G= -5.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TTTAAT. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAACAGTCAGAAAATATAGATTTAATGCTTAGAAAAACTTTTGAACAATTAAACG
GAATTTCGAAAGATGAATTAATCGAAAAACGTTATGAAAAATATATGAAAATTGGGCA
AGTTTCGTTTTCAAACGCTTCCATTTGGATAAAATAAgaaaagcgtgcgttccacttcgcgaatgcacgtttt
tattatgaaaagacacatcttctccattgtatttttatattttttcgtgttattttattataaggcaaataatctttatgaggtgagtacaaATG

   ق Gene: pfk     GI: 47530139     BI number: GBAA4844     GOG: COG0205     Description: phosphofructokinas GG G  C TA TA A  G       TT AT       A  T AT        CG AT        CG GC        TA TG       |  T AT       |  A T  |      |  A       tt A  |      |  A      c  c T  |      |  A      a  g A  |      |  T      c  c A  |      |  A       cg AT       |  A       ta AT       |  g       ta AT       |  a       gt GC       |  a       cg TA       |  a       gc A  |       Ta        ta TA        Cg        gc TA        Gc        cg GC        Cg        gt CG        At        at                         tttattatgaaaagacacatcttctccattgtatttttatattttttcgtgttattttattataaggcaaataatctttatgaggtgagtacaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0205 6-phosphofructokinase ... can be seen here     ..................................................................................................................