Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:100 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-12.50 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

acggatactctcttatcccgagctggcggagggacaggcccgatgaagcccagcaacctcacttgtagtggtaaatacaggtgaataggtgctaaaacct
gtgcgaggctacaggtctcgaacgataagagcgaagggcaaaaagcagtatgcaagtagcaaattaaacctttcctctatataaagtaggaaaggttttt
ctgtatgcttgtgtgggagaataaatgtatgtcgcaatctgtggcaaattaaggatgagttccgtacaatatatacaattactgtagggaggtttaccac
ATG

    metK


Gene: metK     GI: 47530320     BI number: GBAA5017     GOG: COG0192     Description: S-adenosylmethionine synthetas


  g
a  t
a  a
 cg
 gc
 ta
a  a
 ta
 gt
 at        at
c  a      t  a
g  a      a  a
a  a       ta
a  |       cg
a  |      |  t
a  |       ta
a  |       cg
c  |       cg
 gc        ta
 gc        ta
 gt        ta
 at        cg
 at        cg
 gc        at
            ttttctgtatgcttgtgtgggagaataaatgtatgtcgcaatctgtggcaaattaaggatgagttccgtacaatatatacaattactgtagggaggtttaccacATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[H] COG0192 S-adenosylmethionine synthetase ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Methionine_S-box sequence ... can be seen here

    ..................................................................................................................