                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-27.60 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-14.81 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-12.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: AGGGTGGAACCGCG is shown in italic-bold style

tgttcattattattaatataagtagcgatgacggacttataagtacttgcacaaaaagcgattcagggatagtgaaagcctgaagccgcaaggaaacggc
agtctcgagcaatacgtgataaaGTGGATGCACCTTTTGTGTATCAACTAGGGTGGAACCGCGGGCA
AACGCTCGTCCCTAGGCAATTAAGCCTTGGGATGAGCGTTTTTTTATGTTTTTCAAAG
CATATACTGCTCGTTTCACAAGTTACCTGAgcacgtcatcgccaatacgttaactttcaaaaggaggattttattAT
G

    glyS Gene: glyS     GI: 47530451     BI number: GBAA5147     GOG: COG0423     Description: glycyl-tRNA synthetas AT T  C G  A TA GC T  T T  | TA        AA TG       A  C CG        CG        TT CG        GC       A  A AT        GT       A  A CG        GC        CG G  G       CG        GC T  A       GT        GC A  A      C  |       AT GC       C  |      T  T GC       A  |       CG TG       A  |       CG GC       G  |       CG a  G      G  |       TA a  G      T  |       GT a  G       GC        CG t  C       GC        TA a  A       GC        CG g  A       AT        GC tA        TA        CG gC        CG        AT                         TTTTTTATGTTTTTCAAAGCATATACTGCTCGTTTCACAAGTTACCTGAgcacgtcatcgccaatacgttaactttcaaaaggaggattttattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0423 Glycyl-tRNA synthetase (class II) ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................