                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:34 nt.    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-16.10 kcal/mol
Antiterminator:    Distance from promoter:12 nt. Size=34 nt.     Delta G= -5.11 kcal/mol
Anti-antiterminator:    Distance from promoter:16 nt.    Size=10 nt.     Delta G= -1.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaga-tacttt. It has a score value of 72.96 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggaaccacg is shown in italic-bold style

ttgagaaattggtgaagtgtgttactttgcgaattgaaacaagggtggaaccacgaatataacactcgtcccttttttagggaggagtgtttttttattt
catttttgcatcacactaggattggaaggaggatacgcagcATG

    GBAA5261 Gene: GBAA5261     GI: 47530568     BI number: GBAA5261     GOG: COG0531     Description: amino acid permease family protei             a           t  a           a  c           t  a           a  c            at            gc            cg         t            at       t  t           c  |      t  t           c  |       ta           a  |       cg           a  |       cg           g  |       cg           g  |       ta           t  |      g  g aa        gc        cg g  c       gc        ta gc        gc        cg ta        at        at gc        at        cg                         tttttttatttcatttttgcatcacactaggattggaaggaggatacgcagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0531 Amino acid transporters ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames_0581 This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:43 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-18.70 kcal/mol Antiterminator: Size=34 nt.     Delta G= -5.11 kcal/mol Anti-antiterminator:   Size=52 nt.     Delta G=-11.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case The T-box sequence: agggtggaaccacg is shown in italic-bold style gaagtgatgatgaggacacgatcaattttttacgattctcagagagggaagcctttggctgtgagcttcctaatacgaaaaaatggattaccacctctga actgcagcagtgaacgaacatctagtaattgcttgccggcaaaaaccgttattttagacttgagaaattggtgaagtgtgttactttgcgaattgaaaca agggtggaaccacgaatataacactcgtcccttttttagggaggagtgtttttttatttcatttttgcatcacactaggattggaaggaggatacgcagc ATG     GBAA5261 Gene: GBAA5261     GI: 47530568     BI number: GBAA5261     GOG: COG0531     Description: amino acid permease family protei   g t  t gt ta gc at at         g gt       g  a tg       t  a gc       g  c g  g      g  c ta        ga         t ta        ac       t  t at        ag       t  t at        ca        ta |  g      a  |       cg a  a      a  |       cg g  a      a  |       cg a  a      g  |       ta gc       t  |      g  g ta       t  |       cg ta       a  |       ta cg        aa        cg a  g       gt        at g  g       ca        cg at        gt        at tg        ta        at                         tttttatttcatttttgcatcacactaggattggaaggaggatacgcagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0531 Amino acid transporters ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames_0581 This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-11.80 kcal/mol Antiterminator: Size=34 nt.     Delta G= -5.11 kcal/mol Anti-antiterminator:   Size=52 nt.     Delta G=-11.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case The T-box sequence: agggtggaaccacg is shown in italic-bold style gaagtgatgatgaggacacgatcaattttttacgattctcagagagggaagcctttggctgtgagcttcctaatacgaaaaaatggattaccacctctga actgcagcagtgaacgaacatctagtaattgcttgccggcaaaaaccgttattttagacttgagaaattggtgaagtgtgttactttgcgaattgaaaca agggtggaaccacgaatataacactcgtcccttttttagggaggagtgtttttttatttcatttttgcatcacactaggattggaaggaggatacgcagc ATG     GBAA5261 Gene: GBAA5261     GI: 47530568     BI number: GBAA5261     GOG: COG0531     Description: amino acid permease family protei   t g  g ga ta tg at ag         g at       g  a gg       t  a at       g  c g  t      g  c ta        ga tc        ac ct        ag at        ca |  t      a  |        t g  g      a  |      t  t a  c      a  |      t  t t  g      g  |       ta ta       t  |       cg ta       t  |       cg tt       a  |       cg at        aa        ta t  g       gt       g  g t  a       ca        cg ga        gt        ta ca        ta        cg                         tgtttttttatttcatttttgcatcacactaggattggaaggaggatacgcagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0531 Amino acid transporters ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................