                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:107 nt.    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-11.60 kcal/mol
Antiterminator:    Distance from promoter:82 nt. Size=34 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ATGACC-TCTAAT. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGACCTTTTAGAAAAATATCATCTAATGATTCCAGTTGTAGAAATAGACGAAAAACA
AGTAGAATATGGTAACATTCACAAAGGTGTCATAATAAACTATATAAAGAATGCAGTT
AAGAGTTGAataagtttctatctcctgttacaataatacacgtagcagggattatttttttaacctatgtgggacgcaaaatgtcactacggga
cgtaaagtgaccacagaggaaaaatgaaccaatgtagtgaggagaaaagatATG

   ق --- gap Gene: cggR     GI: 47530680     BI number: GBAA5370     GOG: COG2390     Description: gapA transcriptional regulator CggR Gene: gap-2     GI: 47530679     BI number: GBAA5369     GOG: COG0057     Description: glyceraldehyde 3-phosphate dehydrogenas   a a  g t  t at        at At       a  a Gc       t  c |  t      a  a T  a      a  c T  t       cg Gc        at At        ta Gc        tg A  |       gc A  |       ta T  |       cg T  |       cg Gc       t  | At        cg Cg        ta Gt        at             tatttttttaacctatgtgggacgcaaaatgtcactacgggacgtaaagtgaccacagaggaaaaatgaaccaatgtagtgaggagaaaagatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG2390 Transcriptional regulator, contains sigma factor-related N-terminal domain ... can be seen here [G] COG0057 Glyceraldehyde-3-phosphate dehydrogenase/erythrose-4-phosphate dehydrogenase ... can be seen here     ..................................................................................................................