Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:98 nt.    Distance to gene:123 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-17.00 kcal/mol
Antiterminator:    Distance from promoter:71 nt. Size=41 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ATGACA-TAAAGT. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGACAGCTGCAAAAGAAGCTGGTAAAGTTCGTTTAGAAGGAAAAGAGTATATCGTAA
AAGACGGAGACGTTATGCATTTCCGTTTCAACGTTTAAtttaatatttcctaggaaaaataaagatatgaac
ttggcaaatatattatgtgtttgccaagttttttatgtatgggtgagttgattcatctaacttactatgatataatctaaactcgtgagtaattactata
aattaattgctccttgcccattacgggccgtttagaccaaaaggaggtgaaagtgtaATG

   ف --- ssb


Gene: rpsF     GI: 47531060     BI number: GBAA5723     GOG: COG0360     Description: ribosomal protein S6
Gene: ssb-1     GI: 47531059     BI number: GBAA5722     GOG: COG0629     Description: single-stranded DNA-binding protei


 ag
a  a
 at
 ta
 at         t
a  g      t  a
a  a      a  t
a  a       tg
a  |       at
 gc        tg
 gt        at
 at        at
 tg        at
 cg        cg
c  c       gc
 ta        gc
 ta        ta
 ta        ta
 at        cg
 ta        at
 at        at
            ttttatgtatgggtgagttgattcatctaacttactatgatataatctaaactcgtgagtaattactataaattaattgctccttgcccattacgggccgtttagaccaaaaggaggtgaaagtgtaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0360 Ribosomal protein S6 ... can be seen here
[L] COG0629 Single-stranded DNA-binding protein ... can be seen here

    ..................................................................................................................