Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:160 nt.    Distance to gene:54 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.30 kcal/mol
Antiterminator:    Distance from promoter:125 nt. Size=43 nt.     Delta G= -6.10 kcal/mol
Anti-antiterminator:    Distance from promoter:87 nt.    Size=52 nt.     Delta G= -5.55 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-tttatt. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaagttagaggggatggattttattcatttatggggagttgttttatttagttttgagatcttttttagacaataactgaaaagggaatttcttaag
aatgaataaagctatcagtatctttttgttgtaacatatactttgtatatgtggagtgtttggtttgattaaatttagtttaaaatgaggcaactttcct
tttggagagttgtcttttatgctttacagtaaatatataggcaagtaattagagtgaatggggaaggttgaaGTG

    GBAA0335


Gene: GBAA0335     GI: 47777804     BI number: GBAA0335     GOG: -------     Description: hypothetical protei


  t
t  t
 cg
 at
 ta
 at        at
 ta       a  t
 at        at
 cg        ta
 at        tg
a  g       at
t  g       gt
g  a      |  t
t  g      |  a
t  t       ta
g  g       ta        tt
t  t       ta       t  t
t  t       gt        cg
t  t      g  g       cg
t  |       ta        ta
t  |       tg        tg
 cg        tg        ta
 tg        gc        cg
 at       |  a       at
t  |       ta        at
 gt        gc        cg
 at        at        gt
 cg        gt        gc
                        ttttatgctttacagtaaatatataggcaagtaattagagtgaatggggaaggttgaaGTG


    ..................................................................................................................