Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:34 nt.    Distance to gene:115 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-13.40 kcal/mol
Antiterminator:    Distance from promoter:14 nt. Size=39 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttcaat-tacatt. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttcaatcattcgtcagagaaggttacattacgttatataggggtaaaccaagatgcaatggataaagcaatgactaggtttaaaatctaagcattgcttt
ttctttttaaaactatacacttactcataaatttcatactgtgtaactcaaaagggaaagtttaattaagtcaatgataccaagggatttggcgaagggg
tcagttacacacaatataagatATG

    GBAA0459


Gene: GBAA0459     GI: 47777817     BI number: GBAA0459     GOG: -------     Description: hypothetical protei


  a
t  t
a  a
 tg
 tg
g  g
 cg
 at
 ta
t  |
a  |
c  |       ga
a  |      g  t
 ta       t  a        a
 ta       a  a      t  a
 gc       a  a       ta
 gc        cg        ta
a  a       gc        gt
a  a       ta        gc
g  |      |  a       at
a  |      |  t       ta
g  |      |  g      c  a
a  |      a  a      a  g
 cg        gc        gc
 ta        at        ta
 gt       a  a       at
 cg        cg        at
|  c       cg        cg
 ta        at        gc
 ta        at        at
 at        at        at
 cg        ta        at
                        ttctttttaaaactatacacttactcataaatttcatactgtgtaactcaaaagggaaagtttaattaagtcaatgataccaagggatttggcgaaggggtcagttacacacaatataagatATG


    ..................................................................................................................