                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:117 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.20 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -4.56 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaaagatgatccaacacttggcccgtataaccacggcttcttattaggaagtacgagtgatatttcatttgaaacacaaggtatattggatgagaggtt
agagattgtacaagaaagtggtcaagggcacggtggacattaatgaaatgagaaaagatgctactaaggtagtgtctttttctttaggaaacttttacat
agcacaaaatcctctactcgttatataataaccttcgtgcagtcggccttgattttcttacggagaaaatcaaatgataaaagagtagaggagtggtact
TTG

    GBAA0653 Gene: GBAA0653     GI: 47777841     BI number: GBAA0653     GOG: COG0659     Description: sulfate permease family protei   t a  g a  a a  g g  a t  a       aa a  a      t  g a  a       cg tg        at ta        ta at        cg cg        gt a  |       tg gc        at gt        gc ta        at gc        at gt        at             ttctttaggaaacttttacatagcacaaaatcctctactcgttatataataaccttcgtgcagtcggccttgattttcttacggagaaaatcaaatgataaaagagtagaggagtggtactTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0659 Sulfate permease and related transporters (MFS superfamily) ... can be seen here     ..................................................................................................................