Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:166 nt.    Distance to gene:43 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.90 kcal/mol
Antiterminator:    Distance from promoter:136 nt. Size=45 nt.     Delta G=-18.00 kcal/mol
Anti-antiterminator:    Distance from promoter:102 nt.    Size=47 nt.     Delta G=-10.12 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgact-taaagt. It has a score value of 85.01 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacttttgttttgtaagcgagtaaagttagggaagaaattattattaaaaaataaatatgaaaccttcttataaagagaggcggagggactggcccta
cgatgcctcggcagcggactcgattttagagtgctgtgccaaatccagcaagcatgtgcttgaaagatgagaagagcgtttcttatagatgtataagacc
tcttctcgttggaagaggtcttttgttattcattagaaaaaaggttgaaactagggagagatggtactTTG

    GBAA1452


Gene: GBAA1452     GI: 47777931     BI number: GBAA1452     GOG: COG1757     Description: Na+/H+ antiporter family protei


 tg
a  t       ga
 cg       a  t
 gc        tg
 at        at
 at        ta
 cg       t  t
g  a      c  a
a  a       ta
c  a       tg
 cg        ta
 ta        gc        gt
 at       c  |      c  t
a  g       gc        tg
a  a       at        cg
c  g       gc        ta
c  a       at        ta
g  a       at        cg
t  g       gc        ta
g  |       at        cg
 ta        gc        cg
 cg        tg        at
 gc        at        gc
 tg        gt        at
                        tttgttattcattagaaaaaaggttgaaactagggagagatggtactTTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG1757 Na+/H+ antiporter ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Methionine_S-box sequence ... can be seen here

    ..................................................................................................................