                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-22.40 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -7.20 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-16.04 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggcaccgcg is shown in italic-bold style

aataagatgaatttttcacagagagctccatttagctgaaaaggagtaaaaattctttattgaaccaagcctctgagcagcgcatcggaatctattaata
gagggtggtgtgacgggagctcccgttatagagctatggtataagcatgaatgaaaatgcagtaccagataaggttaatatggtgacatattaacaaact
agggtggcaccgcgatgataaatctcgtccctaagactaaaagtcttgggggtgggatttttttattggtttaaaacaatttgaaaagcgggggcctaaa
ATG

    GBAA2649 Gene: GBAA2649     GI: 47778075     BI number: GBAA2649     GOG: COG0477     Description: permease, putativ tg g  a gc         t ta       a  a        a at       g  a      a  a ta        ta       t  a at        at        cg at        gc        at ta       c  t       gc ta        gc        at gc        cg        at g  a      c  t       tg a  a      a  |       cg a  a      c  |       cg t  c      g  |       cg a  t      g  |      t  g g  a      t  |      g  t a  g       gc        cg cg        gc        tg cg        gc        cg at        at        ta tg        ta        at                         ttttttattggtttaaaacaatttgaaaagcgggggcctaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................