                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:200 nt.    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-25.40 kcal/mol
Antiterminator:    Distance from promoter:183 nt. Size=38 nt.     Delta G= -5.81 kcal/mol
Anti-antiterminator:    Distance from promoter:198 nt.    Size=8 nt.     Delta G= -0.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgttt-taaact. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: aaggtggtaccgcg is shown in italic-bold style

ttgtttggaagtgaaatgtgataaactgtaaaaaataacgaaaagcgatgaaagagaagagtacatattcaaaacttttcagagagctgatatgtggtgg
aaatcagtaagggatgaatatggaatgggctctggagcttctaactgaaatgagtaggtaaagacggttgcttcacgttaagaagttgaagtgagctatt
catgatagctaattaaggtggtaccgcgggagtctctcgtccttttttaaggatgaggggctctttttattttgagaaaggaggagttaggTTG

    GBAA3408 Gene: GBAA3408     GI: 47778154     BI number: GBAA3408     GOG: COG0180     Description: tryptophanyl-tRNA synthetase, putativ         t       g  c       a  t        gc        gt        tt        gc       t  t        cg        ta        gt        ta       c  |       cg       c  |       cg       a  |       ta       t  |       gt       g  |       cg       g  |       ta       t  |       cg        gc        tg        gc        cg        at        tg        at        gc       t  t       at       t  t       gc        at        gt        at        gt                         tttattttgagaaaggaggagttaggTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0180 Tryptophanyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................