                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:42 nt.    Distance to gene:21 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-16.90 kcal/mol
Antiterminator:    Distance from promoter:32 nt. Size=24 nt.     Delta G= -7.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcat-tatatt. It has a score value of 81.66 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcatttaagcagaaataccattatatttgtattaacaactatataaataaatcataatttacgtgaaggacacaccttacgtaccatcccaacggtac
aggtgtgtccttttttacgttctaggaggaaaatataATG

    GBAA_pXO1_0046 --- GBAA_pXO1_0045 Gene: GBAA_pXO1_0046     GI: 47566368     BI number: GBAA_pXO1_0046     GOG: -------     Description: hypothetical protein, (pXO1-32) Gene: GBAA_pXO1_0045     GI: 47566367     BI number: GBAA_pXO1_0045     GOG: -------     Description: hypothetical protein, (pXO1-31            cc           c  a           t  a           a  c            cg            cg            at   a        ta c  c       gc a  a      c  | gc       a  | gc       t  | a  |       ta at        cg gt        cg ta        at gc        cg cg        at at        cg ta        at             ccttttttacgttctaggaggaaaatataATG     ..................................................................................................................