Gene putatively regulated by attenuation in B_anthracis_Ames_0581_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:82 nt.    Distance to gene:46 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-27.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TAGACA-AAAAAT. It has a score value of 70.28 and is shown in blue

TAGACATCAGTGTGTTTGTTATGAAAAATACTTTGAGTAAtataggtagtttacttttattatttgagta
aataacaggtttgtcataactatccaacttttaaataactttgataccctcctatcatctgtttgatgggagggtatcatgtttttaaaggtaaattcaa
ataatttcatgatatttttacacttaggttaATG

    GBAA_pXO1_0055


Gene: GBAA_pXO1_0055     GI: 47566376     BI number: GBAA_pXO1_0055     GOG: -------     Description: IS231-related, transposase, (pXO1-36


          tg
         c  t
         t  t
          at
          cg
          ta
          at
          tg
          cg
          cg
          ta
          cg
          cg
          cg
          at
          ta
          at
          gc
          ta
            tgtttttaaaggtaaattcaaataatttcatgatatttttacacttaggttaATG


    ..................................................................................................................