                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:45 nt.    Distance to gene:127 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-13.20 kcal/mol
Antiterminator:    Distance from promoter:47 nt. Size=16 nt.     Delta G= -3.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaat-tatcct. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttaattactttggggtaatgaatatcctatacaggttaagTTAACATAACGCATCATTATCGGTAGCAAAGAAA
AAGGAGGGAACCCTACTCTCACAAGGGAACCTTCTTTTTTGTTCTATGGAGCTATAAA
TTTTTTTATACATtcctattctagcgcggttttagggttcttgtttgttactggatttgccgaaaaactgtataaaatcttgtatactctt
agcttaggggttttccgaaATG

    GBAA_pXO1_0058 Gene: GBAA_pXO1_0058     GI: 47566379     BI number: GBAA_pXO1_0058     GOG: -------     Description: hypothetical protei             T           C  C           T  A           C  C           A  A            TA            CG            CG            CG           A  A           A  A           G  | AA        GC G  C       GC GC        AT GC        GT AT        GC G  A       AT GC        AT AT        AT             TTTGTTCTATGGAGCTATAAATTTTTTTATACATtcctattctagcgcggttttagggttcttgtttgttactggatttgccgaaaaactgtataaaatcttgtatactcttagcttaggggttttccgaaATG     ..................................................................................................................