Gene putatively regulated by attenuation in B_anthracis_Ames_0581_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-10.00 kcal/mol
Antiterminator: Size=65 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-11.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aatccagtaacaaacaagaaccctaaaaccgcgctagaataggaATGTATAAAAAAATTTATAGCTCCATAGAACA
AAAAAGAAGGTTCCCTTGTGAGAGTAGGGTTCCCTCCTTTTTCTTTGCTACCGATAAT
GATGCGTTATGTTAActtaacctgtataggatattcattaccccaaagtaattaaaatatgctttgggttttgtattttccaagataag
gtgtaaatatatctttacatttatactgtttttatataatctattagtaaagatatctttacattgcaggtgaaatgATG

    GBAA_pXO1_0060 --- GBAA_pXO1_0061


Gene: GBAA_pXO1_0060     GI: 47566381     BI number: GBAA_pXO1_0060     GOG: -------     Description: DNA-binding protein, (pXO1-40)
Gene: GBAA_pXO1_0061     GI: 47566382     BI number: GBAA_pXO1_0061     GOG: -------     Description: hypothetical protein, (pXO1-41


            a
          a  c
          t  c
          t  t
           cg
           At
          |  a
           At
           Ta
  A        Tg
G  G      G  g
T  A       Ta
G  G       At
T  T       Ta
 TA       T  t
 CG       G  |
 CG       C  |
 CG       G  |
|  T      T  |
|  T       At
|  C       Gc
|  C       Ta
T  C       At         a
T  T       At       a  a
 GC        Ta       t  a
 GC       |  c      t  t
 AT       A  c      a  a
 AT       G  c       at
 GT       C  c       tg
 AT       C  a       gc
 AT       A  a       at
A  C       Ta        at
 AT        Cg        at
 AT        Gt        cg
 AT        Ta        cg
 CG        Ta        cg
                        ttttgtattttccaagataaggtgtaaatatatctttacatttatactgtttttatataatctattagtaaagatatctttacattgcaggtgaaatgATG


    ..................................................................................................................