                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-10.00 kcal/mol
Antiterminator: Size=65 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-11.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aatccagtaacaaacaagaaccctaaaaccgcgctagaataggaATGTATAAAAAAATTTATAGCTCCATAGAACA
AAAAAGAAGGTTCCCTTGTGAGAGTAGGGTTCCCTCCTTTTTCTTTGCTACCGATAAT
GATGCGTTATGTTAActtaacctgtataggatattcattaccccaaagtaattaaaatatgctttgggttttgtattttccaagataag
gtgtaaatatatctttacatttatactgtttttatataatctattagtaaagatatctttacattgcaggtgaaatgATG

    GBAA_pXO1_0060 --- GBAA_pXO1_0061 Gene: GBAA_pXO1_0060     GI: 47566381     BI number: GBAA_pXO1_0060     GOG: -------     Description: DNA-binding protein, (pXO1-40) Gene: GBAA_pXO1_0061     GI: 47566382     BI number: GBAA_pXO1_0061     GOG: -------     Description: hypothetical protein, (pXO1-41             a           a  c           t  c           t  t            cg            At           |  a            At            Ta   A        Tg G  G      G  g T  A       Ta G  G       At T  T       Ta TA       T  t CG       G  | CG       C  | CG       G  | |  T      T  | |  T       At |  C       Gc |  C       Ta T  C       At         a T  T       At       a  a GC        Ta       t  a GC       |  c      t  t AT       A  c      a  a AT       G  c       at GT       C  c       tg AT       C  a       gc AT       A  a       at A  C       Ta        at AT        Cg        at AT        Gt        cg AT        Ta        cg CG        Ta        cg                         ttttgtattttccaagataaggtgtaaatatatctttacatttatactgtttttatataatctattagtaaagatatctttacattgcaggtgaaatgATG     ..................................................................................................................