Gene putatively regulated by attenuation in B_anthracis_Ames_0581_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:102 nt.     Distance to run of Ts=1 nt.   Size=38 nt.     Delta G=-10.90 kcal/mol
Antiterminator: Size=17 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aatataaacgtgctgaacttaatacgaacgaaaaactgtgtattaatcacccacatgatcgcctctcaatcaataaccaaccccttacgaacaagaaacc
aatcacattcatcgcactcacctaatcaccggtcagttaatatatttaagttgcaatcactcatataaattgagtggtgattgagtggttggttttgtta
tgttcaatctagtcttgctcagtcaattaatcaccagtcagctgtatgattttagttcgtatttctaaagatgggtaaccagtgattgggcggttgagag
GTG

    GBAA_pXO1_0071


Gene: GBAA_pXO1_0071     GI: 47566392     BI number: GBAA_pXO1_0071     GOG: -------     Description: hypothetical protei



           ag
          g  t
           tg
           tg
           at
          a  g
          a  a
          t  t
          a  |
          t  |
           at
  a        cg
t  a       ta
a  a       cg
t  t       at
 at        cg
 cg        tg
 ta        at
 cg        at
 at        cg
            gttttgttatgttcaatctagtcttgctcagtcaattaatcaccagtcagctgtatgattttagttcgtatttctaaagatgggtaaccagtgattgggcggttgagagGTG


    ..................................................................................................................