Gene putatively regulated by attenuation in B_anthracis_Ames_0581_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:79 nt.    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.10 kcal/mol
Antiterminator:    Distance from promoter:35 nt. Size=53 nt.     Delta G= -6.20 kcal/mol
Anti-antiterminator:    Distance from promoter:8 nt.    Size=36 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TGGAAA-TACAAT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGAAAGCAATCCAAGGTGGTTATGATACAATTCTAGCTCGATTCACAAAAGCATCAA
GTAATGCGGATGTAGATTCTTGGAACAAAAAATAAattttgattgaaaataagagggggcgtgttttatatagc
tcccttcttttaaaacataaggaggtactatgATG

    GBAA_pXO1_0091


Gene: GBAA_pXO1_0091     GI: 47566412     BI number: GBAA_pXO1_0091     GOG: -------     Description: hypothetical protein, (pXO1-65


           Aa
          A  t
          T  t
           At
           At
          A  g
          A  a
           At
           At
 AG        Cg
A  T      |  a
C  A      A  a
 TA       A  a
 AT       G  a        t
 CG        Gt       t  a
 GC        Ta       t  t
A  G       Ta        ta
A  G       Cg        gt
A  A       Ta        ta
 AT        Tg       g  |
 CG       A  g       cg
 AT       G  g       gc
C  A      A  g       gt
T  G       Tg        gc
 TA        Gc        gc
 AT        Tg        gc
 GT        At        at
                        tcttttaaaacataaggaggtactatgATG


    ..................................................................................................................