Gene putatively regulated by attenuation in B_anthracis_Ames_0581_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:114 nt.    Distance to gene:116 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-12.00 kcal/mol
Antiterminator:    Distance from promoter:51 nt. Size=69 nt.     Delta G=-13.83 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAG-TAAACT. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAGTTTTAATTCAACAGGTAAACTTCTTAGAACCACGACAATTTAAAGTGCAGGT
AAACAAATATGCACAAATTGTAACACCAATTGCACAAATTCCACATGGACAAGAAGAA
GTACCTGTGGATTAAgaaaaaatgagggttgtggaagaaaaaacacaacccttttataaaaaagaaagagtacctaaatttatttattg
aatattcataattttctgatataataaaccatagttaaatgaaatttgtatatagcgctaaaatgaatatggaggaatacaaATG

    GBAA_pXO1_0113 --- GBAA_pXO1_0114


Gene: GBAA_pXO1_0113     GI: 47566433     BI number: GBAA_pXO1_0113     GOG: -------     Description: hypothetical protein, (pXO1-83)
Gene: GBAA_pXO1_0114     GI: 47566434     BI number: GBAA_pXO1_0114     GOG: -------     Description: conserved hypothetical protein, (pXO1-84


 AA
G  G
A  A
A  A
 CG
 AT
|  A
 GC
 GC
T  |
 AT
 CG
 AT
 CG
 CG
 TA
|  T
T  T
A  A
A  A
A  g
C  a
A  a
C  a
G  a       aa
 Ta       g  a
 Ta       a  a
 At       a  a
|  g      g  a
A  a       gc
 Cg        ta
 Cg        gc
A  |       ta
 Cg        ta
 At        gc
 At        gc
 Tg        gc
            ttttataaaaaagaaagagtacctaaatttatttattgaatattcataattttctgatataataaaccatagttaaatgaaatttgtatatagcgctaaaatgaatatggaggaatacaaATG
    ..................................................................................................................