                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:151 nt.    Distance to gene:19 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G=-11.30 kcal/mol
Antiterminator:    Distance from promoter:136 nt. Size=32 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:    Distance from promoter:118 nt.    Size=36 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttcaca-taaaat. It has a score value of 73.63 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttcacaccatgttattagtatataaaattctcccaccaaacaaataaattaggaattatgttatcaattttttatcctggattcttatcatctatagcat
tctatataaatcttatggtattatatagatagaaaatttgtttccattgtttatactctattgtacgtagcgtgaaggacaaaccttacgccctgttaac
tcgggcgaagtttgtcctttttttactttaaggaggaatttactATG

    GBAA_pXO1_0118 --- GBAA_pXO1_0117 Gene: GBAA_pXO1_0118     GI: 47566438     BI number: GBAA_pXO1_0118     GOG: -------     Description: hypothetical protein, (pXO1-87) Gene: GBAA_pXO1_0117     GI: 47566437     BI number: GBAA_pXO1_0117     GOG: COG2311     Description: membrane protein, putative, (pXO1-86   t                   a g  a                t  a t  c        a       t  c tg       c  a      g  t at       a  a      t  c ta        gc        cg cg        gc        cg t  c      a  |       cg cg        at        gc at        gt        cg tg        ta       a  | |  a       gc        ta a  a       cg        ta tg        gc       c  | tg       a  c       cg ta       t  c       at gc        gt        at ta        cg        at ta        at        cg                         tcctttttttactttaaggaggaatttactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2311 Predicted membrane protein ... can be seen here     ..................................................................................................................