                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:65 nt.    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-13.20 kcal/mol
Antiterminator:    Distance from promoter:59 nt. Size=27 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttctaa-tatagt. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttctaactttaacaatgaaccttttatagtggtaagattttgtacaattagaaaagacatcttgggctttacctgaactgtcccccgaattatggacact
taaaaaagccccatgattcggggtttttgtgtatttttatcaaaaaacctcattataatggagccaacgatagaaatgagtacggagaATG

    GBAA_pXO1_0126 Gene: GBAA_pXO1_0126     GI: 47566446     BI number: GBAA_pXO1_0126     GOG: -------     Description: hypothetical protei             a           g  t           t  t           a  c            cg            cg            cg aa        cg a  a       gt ta        at ta        at cg        at a  c       at c  c      a  | a  |      a  | gc       t  | gc       t  | ta        cg at        at tg        cg ta        at             atttttatcaaaaaacctcattataatggagccaacgatagaaatgagtacggagaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames_0581_pl-pXO1                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:54 nt.    Distance to gene:59 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-14.50 kcal/mol Antiterminator:    Distance from promoter:25 nt. Size=27 nt.     Delta G= -3.90 kcal/mol Anti-antiterminator:   Size=52 nt.     Delta G= -4.20 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttctaa-tatagt. It has a score value of 60.24 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttctaactttaacaatgaaccttttatagtggtaagattttgtacaattagaaaagacatcttgggctttacctgaactgtcccccgaattatggacact taaaaaagccccatgattcggggtttttgtgtatttttatcaaaaaacctcattataatggagccaacgatagaaatgagtacggagaATG     GBAA_pXO1_0126 Gene: GBAA_pXO1_0126     GI: 47566446     BI number: GBAA_pXO1_0126     GOG: -------     Description: hypothetical protei tt a  t g  t a  g at ta gc g  a ta                  aa gt                 a  a at                  ta ta                  ta a  g                 cg ta        tt       a  c ta       t  a      c  c ta        cc       a  | ta        gc        gc cg        gt        gc |  a      g  g       ta c  c      t  a       at a  a      t  |       tg at        ca        ta gc        tc        at t  |       at        at at        cg        gc at        at        cg cg        gc        cg                         ggtttttgtgtatttttatcaaaaaacctcattataatggagccaacgatagaaatgagtacggagaATG     ..................................................................................................................