                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:155 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-12.60 kcal/mol
Antiterminator: Size=58 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCTATTATGACGACGGAACGTTATTTAAGAGAACGTACAAGACGTCAAAACTTGGCC
ACAATAGATATAGGAAATTCATTGTTTTAGTAAACATATATAATAGGAAGATTCTCGA
TTTGATGCATCGGTTTCTTCCTATTTTTTTGCTCATAGAACTTTAAATCCTTCTCTTT
CACCATaatattttgactatttattgcgaataaaaaataaatatgacttattataagtcctgcgagtaaaatttatcttttctattttacaggaac
gttataaatcagaaaggaaaagggaatgatATG

    GBAA_pXO1_0180 --- GBAA_pXO1_0179 Gene: GBAA_pXO1_0180     GI: 47566492     BI number: GBAA_pXO1_0180     GOG: -------     Description: conserved hypothetical protein Gene: GBAA_pXO1_0179     GI: 47566491     BI number: GBAA_pXO1_0179     GOG: -------     Description: hypothetical protein, (pXO1-104   A A  C A  A T  T G  A AT TA T  T TA TA GT         A TA       G  T TG       T  G A  |      T  C CG        TA TA        AT TA        GC A  G       CG A  A       TG AT       C  T GT       T  T GC       T  | AT        AT T  C       GC A  G       AT TA        AT AT        GC GT        GC AT        AT TG        TA             TTTTTTTGCTCATAGAACTTTAAATCCTTCTCTTTCACCATaatattttgactatttattgcgaataaaaaataaatatgacttattataagtcctgcgagtaaaatttatcttttctattttacaggaacgttataaatcagaaaggaaaagggaatgatATG     ..................................................................................................................