Gene putatively regulated by attenuation in B_anthracis_Ames_0581_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:155 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-12.60 kcal/mol
Antiterminator: Size=58 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCTATTATGACGACGGAACGTTATTTAAGAGAACGTACAAGACGTCAAAACTTGGCC
ACAATAGATATAGGAAATTCATTGTTTTAGTAAACATATATAATAGGAAGATTCTCGA
TTTGATGCATCGGTTTCTTCCTATTTTTTTGCTCATAGAACTTTAAATCCTTCTCTTT
CACCATaatattttgactatttattgcgaataaaaaataaatatgacttattataagtcctgcgagtaaaatttatcttttctattttacaggaac
gttataaatcagaaaggaaaagggaatgatATG

    GBAA_pXO1_0180 --- GBAA_pXO1_0179


Gene: GBAA_pXO1_0180     GI: 47566492     BI number: GBAA_pXO1_0180     GOG: -------     Description: conserved hypothetical protein
Gene: GBAA_pXO1_0179     GI: 47566491     BI number: GBAA_pXO1_0179     GOG: -------     Description: hypothetical protein, (pXO1-104


  A
A  C
A  A
T  T
G  A
 AT
 TA
T  T
 TA
 TA
 GT         A
 TA       G  T
 TG       T  G
A  |      T  C
 CG        TA
 TA        AT
 TA        GC
A  G       CG
A  A       TG
 AT       C  T
 GT       T  T
 GC       T  |
 AT        AT
T  C       GC
A  G       AT
 TA        AT
 AT        GC
 GT        GC
 AT        AT
 TG        TA
            TTTTTTTGCTCATAGAACTTTAAATCCTTCTCTTTCACCATaatattttgactatttattgcgaataaaaaataaatatgacttattataagtcctgcgagtaaaatttatcttttctattttacaggaacgttataaatcagaaaggaaaagggaatgatATG


    ..................................................................................................................