Gene putatively regulated by attenuation in B_anthracis_Ames_0581_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:36 nt.    Distance to gene:41 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-23.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tataaa-tatgat. It has a score value of 67.6 and is shown in blue

tataaaattaataagaactatgatatgatgaaagtaacaaaatacttctaaaactatcttgcaaaaggacacacctacgcatacatatgccataggtgtg
tccttttttatgtatttttaagatttcaagactcaaaagggggatatataTTG

    GBAA_pXO1_0212


Gene: GBAA_pXO1_0212     GI: 47566521     BI number: GBAA_pXO1_0212     GOG: -------     Description: hypothetical protei


          ca
         a  t
          ta
          at
          cg
          gc
         |  c
         c  a
          at
          ta
          cg
          cg
          at
          cg
          at
          cg
          at
          gc
          gc
          at
            tttttatgtatttttaagatttcaagactcaaaagggggatatataTTG


    ..................................................................................................................