                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581_pl-pXO2

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:146 nt.    Distance to gene:9 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G=-12.40 kcal/mol
Antiterminator:    Distance from promoter:117 nt. Size=39 nt.     Delta G= -8.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGA-CAAAAT. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGAGGATGTTGTAACATGTTAGATCAAAATACGGATCGTAGTTGGTGGATGATTG
GTGCAGTTGTTGTAGGTGCTGCTTTAGTAGGGGTTGTTTCTGTTGCTTTTCCTGACTT
AACGCACTCAGTAATCAATGTATTTACAGACAAACTTTCCTCAGTTAAATAAttatatcca
acaaggggagagagaattttctctccttatttgtttgggaaggaGTG

    GBAA_pXO2_0024 --- GBAA_pXO2_0023 --- GBAA_pXO2_0022 --- GBAA_pXO2_0021 --- GBAA_pXO2_0020 --- GBAA_pXO2_0019 --- GBAA_pXO2_0018 --- GBAA_pXO2_0017 Gene: GBAA_pXO2_0024     GI: 47566696     BI number: GBAA_pXO2_0024     GOG: -------     Description: hypothetical protein, (pXO2-26) Gene: GBAA_pXO2_0023     GI: 47566695     BI number: GBAA_pXO2_0023     GOG: -------     Description: bacterial type II/IV secretion system protein, (pXO2-25) Gene: GBAA_pXO2_0022     GI: 47566694     BI number: GBAA_pXO2_0022     GOG: -------     Description: hypothetical protein, (pXO2-24/23) Gene: GBAA_pXO2_0021     GI: 47566693     BI number: GBAA_pXO2_0021     GOG: -------     Description: hypothetical protein, (pXO2-22) Gene: GBAA_pXO2_0020     GI: 47566692     BI number: GBAA_pXO2_0020     GOG: -------     Description: hypothetical protein, (pXO2-21) Gene: GBAA_pXO2_0019     GI: 47566691     BI number: GBAA_pXO2_0019     GOG: -------     Description: hypothetical protein, (pXO2-20) Gene: GBAA_pXO2_0018     GI: 47566690     BI number: GBAA_pXO2_0018     GOG: -------     Description: hypothetical protein, (pXO2-19) Gene: GBAA_pXO2_0017     GI: 47566689     BI number: GBAA_pXO2_0017     GOG: -------     Description: hypothetical protein, (pXO2-18 tt A  a At Ta At A  c A  c Ta        aa Ta       g  t Gc        at |  a       gt A  a       at Cg        gc Tg        at Cg        gc Cg        gt Ta        gc Tg        gc Ta        at Cg        at             atttgtttgggaaggaGTG     ..................................................................................................................