                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames_0581_pl-pXO2

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:56 nt.    Distance to gene:102 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-15.40 kcal/mol
Antiterminator:    Distance from promoter:25 nt. Size=44 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G= -9.94 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtga-taccgt. It has a score value of 70.95 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

ttgtgatgaaagacggtagtttataccgttaacaaatagagtggtgaagtttcttcacaactagggtggtaccgcgatcatttatcgtccctacatgatg
tagggacgttttttgttgtcaaaattaaaaacttaagtttttttataaattaataatattgttaaaggcctgacaatactattttcatcccccaacaaat
aaaaaggagcaatttacATG

    GBAA_pXO2_0078 Gene: GBAA_pXO2_0078     GI: 47566743     BI number: GBAA_pXO2_0078     GOG: COG1280     Description: amino acid efflux protein, (pXO2-63   t t  t gc at at gc ta gc g  a ta gc at g  a        a a  g      g  t t  |      c  c a  |      g  a a  |      c  t a  |      c  t c  |       at a  |       ta a  |       gt t  |       gc t  |       tg g  |      |  t cg        gc         g cg        gc       t  a at        gc       a  t tg        at        cg a  g       ta        at t  t      c  c       ta t  |      a  a       cg ta       a  |       cg gc       c  |       cg a  c       at        ta tg        cg        gc gc        ta        cg                         ttttttgttgtcaaaattaaaaacttaagtttttttataaattaataatattgttaaaggcctgacaatactattttcatcccccaacaaataaaaaggagcaatttacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1280 Putative threonine efflux protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................