                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:199 nt.    Distance to gene:26 nt.     Distance to run of Ts=2 nt.   Size=25 nt.     Delta G= -8.80 kcal/mol
Antiterminator:    Distance from promoter:164 nt. Size=43 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:    Distance from promoter:135 nt.    Size=42 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcta-tattat. It has a score value of 77.64 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgctatagctacttttttttgatattatagttgtgttttcactttgaataagttttccacatctttatcttatccacaatttgtgtataacatgtggac
agttttaatcacatgtgggtaaatgattatccacatttgcttttttgtcgaaaaccctatctcatatacaaacgacgtttttaggttttaaaatacgttt
cgtataaatatacattttatatttattcaggttgtacatttgttgcacaaccttattcttttaccatcttagtaaaggagggacacctTTG

    BAS0001 Gene: BAS0001     GI: 49183040     BI number: BAS0001     GOG: COG0593     Description: chromosomal replication initiator protein Dna             t gt       a  t g  t      c  t a  t       at t  t       ta ta        at ta        ta ta        at ta        at gt        at c  a       ta         t a  |       at       t  g gc       |  t      t  t cg       t  c       at at       g  a       cg at        cg       a  c at        tg        ta |  c      t  t       gc cg       t  |       ta at        gt        ta ta        cg        gc at        at        gc ta        ta        at                         tattcttttaccatcttagtaaaggagggacacctTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0593 ATPase involved in DNA replication initiation ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_str_Sterne                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:80 nt.    Distance to gene:142 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-11.00 kcal/mol Antiterminator:    Distance from promoter:52 nt. Size=45 nt.     Delta G= -7.60 kcal/mol Anti-antiterminator:    Distance from promoter:27 nt.    Size=43 nt.     Delta G= -8.70 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgcta-tattat. It has a score value of 77.64 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgctatagctacttttttttgatattatagttgtgttttcactttgaataagttttccacatctttatcttatccacaatttgtgtataacatgtggac agttttaatcacatgtgggtaaatgattatccacatttgcttttttgtcgaaaaccctatctcatatacaaacgacgtttttaggttttaaaatacgttt cgtataaatatacattttatatttattcaggttgtacatttgttgcacaaccttattcttttaccatcttagtaaaggagggacacctTTG     BAS0001 Gene: BAS0001     GI: 49183040     BI number: BAS0001     GOG: COG0593     Description: chromosomal replication initiator protein Dna   t a  t a  t       tt cg       g  t at       a  t cg       c  a c  t      a  a ta        gt at        gc ta        ta ta        gc        tg c  c       ta       a  a t  |       at        at a  |       cg        at t  |       at        ta t  |      |  g       gt t  |      a  g       gc c  |       tg        gc ta        at        ta at        ta        gc cg       g  a       ta at        ta        at cg        gt       c  t cg        tg        at ta        ta        cg                         cttttttgtcgaaaaccctatctcatatacaaacgacgtttttaggttttaaaatacgtttcgtataaatatacattttatatttattcaggttgtacatttgttgcacaaccttattcttttaccatcttagtaaaggagggacacctTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0593 ATPase involved in DNA replication initiation ... can be seen here     ..................................................................................................................