                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:110 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -5.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGAATTTGGTGGACGTGATCATACAACCGTTATCCATGCCCATGAAAAAATTTCTAA
GCTACTTAAGACGGATACGCAATTACAAAAACAAGTTGAAGAAATTAACGATATTTTA
AAGTAGtagctgaatagtgtgaataacttcccttgttttacgcacagtctatccacatgtagatagactgtttttacatctttcaacggggttatc
cacatatccacaagccctattactattactactattttttatctttattaattaaataaaatcttatacttaccggaggttcttctttATG

    BAS0002 Gene: BAS0002     GI: 49183041     BI number: BAS0002     GOG: COG0592     Description: DNA polymerase III, beta subuni Gt A  a Tg Gc At         c A  |      c  c A  |      t  t T  |      t  t Tg        cg Ta        at Ta       a  | At       t  | Ta        at A  g       at Gt        gt        at Cg        ta       c  g At        gc       a  t A  g       tg       c  a Ta        gc        cg Ta       a  a       ta At       t  |       at A  a      a  |       ta A  a      a  |       cg Gc        gc        ta At        ta        gc At        cg        at Gc        gt        cg                         tttttacatctttcaacggggttatccacatatccacaagccctattactattactactattttttatctttattaattaaataaaatcttatacttaccggaggttcttctttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0592 DNA polymerase sliding clamp subunit (PCNA homolog) ... can be seen here     ..................................................................................................................