Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:82 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.40 kcal/mol

                                                                        Nomenclature/Definitions

ATGGAGAAGAGTTAAAAATATCTTTTAGTGCAAAATATATGATGGATGCACTAAAGGC
ATTAGATAGTACTGAAATTAAGATTAGCTTTACTGGAGCAATGAGACCATTCTTAATT
CGTACGGTAAATGATGAATCCATTATTCAATTAATTTTACCGGTTCGTACTTACTAAg
taagaaataagggttgctagttttcagatgctagtagcccttatttgatttttgggtattactttcctaatgctagtttatttagtacaatgaaagaatg
aacactttcagaaagtgagcgattttATG

    BAS0003 --- BAS0004 --- BAS0005


Gene: BAS0003     GI: 49183042     BI number: BAS0003     GOG: COG2501     Description: conserved hypothetical protein
Gene: BAS0004     GI: 49183043     BI number: BAS0004     GOG: COG1195     Description: DNA replication and repair protein RecF
Gene: BAS0005     GI: 49183044     BI number: BAS0005     GOG: COG0187     Description: DNA gyrase, B subuni


          ca
         t  g
         t  a
         t  t
          tg
          gc
          at
          ta
          cg
          gt
          ta
          tg
          gc
          gc
          gc
            ttatttgatttttgggtattactttcctaatgctagtttatttagtacaatgaaagaatgaacactttcagaaagtgagcgattttATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG2501 Uncharacterized conserved protein ... can be seen here
[L] COG1195 Recombinational DNA repair ATPase (RecF pathway) ... can be seen here
[L] COG0187 Type IIA topoisomerase (DNA gyrase/topo II, topoisomerase IV), B subunit ... can be seen here

    ..................................................................................................................