                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:54 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-17.10 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATATAAAGGACCTTTAGCAGATACAGTTCACCAATTAGTTGGTGGTTTACGTGCAGGT
ATGGGCTATTGCGGAGCACAAGATTTAGAATTCTTACGTGAGAATGCACAATTTATTC
GCATGTCAGGTGCTGGTTTACTTGAAAGCCATCCTCACCACGTACAAATTACAAAAGA
GGCTCCAAACTACTCATTATAAtgtcttatatacaaatagacggagatttgatatctctgtctatttttttttgattatgttag
aataacggttatgtgagtacatagatattgggggtagcaaaaGTG

    BAS0012 Gene: BAS0012     GI: 49183048     BI number: BAS0012     GOG: -------     Description: D-alanyl-D-alanine carboxypeptidas gt t  c At At Ta At Ta         g |  t      t  a T  a      t  t A  c       ta C  a       at T  a       gc C  a       at At        gc Ta        gt Cg        cg A  a       at A  c       gc A  |       at Cg        ta Cg        at Ta        at Cg        at             ttttttgattatgttagaataacggttatgtgagtacatagatattgggggtagcaaaaGTG     ..................................................................................................................