Gene putatively regulated by attenuation in B_anthracis_str_Sterne

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:83 nt.    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-24.80 kcal/mol
Antiterminator:    Distance from promoter:65 nt. Size=31 nt.     Delta G=-10.71 kcal/mol
Anti-antiterminator:    Distance from promoter:32 nt.    Size=40 nt.     Delta G=-14.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tggaat-tatgat. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggcaacgcg is shown in italic-bold style

tggaatggaatgtggaatatctttatgattagtaaacattcccggtgaagagccgttatttctacttgagaggaaggcggtaatgctttcaactagggtg
gcaacgcgggttaactcccgtccctttatatagggacgggagttttttgtgttttataaaataaaaggaggagtatataATG

    BAS0015


Gene: BAS0015     GI: 49183051     BI number: BAS0015     GOG: COG0172     Description: seryl-tRNA synthetas


 ta
g  a       aa
 gt       t  c
 cg       t  t
 gc        gc        at
 gt        gc       t  a
 at        gc       t  t
 at        cg        ta
 gc        gt        cg
g  a      c  |       cg
a  a      a  |       cg
 gc       a  |       ta
 at       c  |       gc
g  a      g  |       cg
t  g      g  |       cg
 tg       t  |       cg
 cg        gc        ta
 at        gc        cg
 tg        gc        at
 cg        at        at
                        ttttgtgttttataaaataaaaggaggagtatataATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0172 Seryl-tRNA synthetase ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:83 nt.    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-24.80 kcal/mol
Antiterminator:    Distance from promoter:50 nt. Size=31 nt.     Delta G=-10.71 kcal/mol
Anti-antiterminator:    Distance from promoter:11 nt.    Size=58 nt.     Delta G=-14.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tggaat-tatgat. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggcaacgcg is shown in italic-bold style

tggaatggaatgtggaatatctttatgattagtaaacattcccggtgaagagccgttatttctacttgagaggaaggcggtaatgctttcaactagggtg
gcaacgcgggttaactcccgtccctttatatagggacgggagttttttgtgttttataaaataaaaggaggagtatataATG

    BAS0015


Gene: BAS0015     GI: 49183051     BI number: BAS0015     GOG: COG0172     Description: seryl-tRNA synthetas


 ag
g  a
 tg
 tg
c  a
a  a
 tg
 cg
t  c
t  g
 tg
 at        gt
 ta       g  g
 ta       g  g
 gt        ac        at
c  |       ta       t  a
 cg        ca       t  t
 gc        ac        ta
 at        ag        cg
 gt       c  |       cg
 at       t  |       cg
a  c      t  |       ta
g  a      t  |       gc
 ta       c  |       cg
 gc       g  |       cg
 gt       t  |       cg
|  a       ac        ta
 cg        ag        cg
 cg        tg        at
 cg        gg        at
                        ttttgtgttttataaaataaaaggaggagtatataATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0172 Seryl-tRNA synthetase ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here

    ..................................................................................................................