                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:83 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-13.00 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -4.74 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-13.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aagtaagtggtgttgacgtttgggtcctgcgcaacgggaccccgtgaaccttgtcaggtccggaaggaagcagcaataagcgggtcttctcgtgtgccgc
aggagtgcctgaaccgagctaactgcttaagtaacgcttatggtacgtaatcgacagaaggtgcacggcagttatatatgtatacaaaactcaccttaat
actaaggtgggttttttgtatagaaaataacttttggaatctataaacagaatgggttataataaatgagataataacctttgagggaggccgtattttc
GTG

    BAS0021 --- BAS0022 --- BAS0023 --- BAS0024 Gene: BAS0021     GI: 49183057     BI number: BAS0021     GOG: COG2812     Description: DNA polymerase III, gamma and tau subunits Gene: BAS0022     GI: 49183058     BI number: BAS0022     GOG: COG0718     Description: conserved hypothetical protein TIGR00103 Gene: BAS0023     GI: 49183059     BI number: BAS0023     GOG: COG0353     Description: recombination protein RecR Gene: BAS0024     GI: 49183060     BI number: BAS0024     GOG: NOG17258     Description: conserved hypothetical protei aa t  t gc cg a  | ta gc g  a       at t  g      t  a a  |      t  t ta       g  a ta        at cg        cg g  |       gt cg       |  a at       |  t a  |      |  a tg       |  c       ta gc       |  a      a  c a  a      |  a       at a  c      g  a       ta t  |      c  a       ta tg       a  c       cg cg       c  t       cg gc        gc        at ta        ta        cg cg        gc        tg at        gc        cg at        at        at ta        at        at                         ttttgtatagaaaataacttttggaatctataaacagaatgggttataataaatgagataataacctttgagggaggccgtattttcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG2812 DNA polymerase III, gamma/tau subunits ... can be seen here [S] COG0718 Uncharacterized protein conserved in bacteria ... can be seen here [L] COG0353 Recombinational DNA repair protein (RecF pathway) ... can be seen here     ..................................................................................................................