                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:45 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -7.80 kcal/mol
Antiterminator: Size=58 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -3.31 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

taaggaatagaagtataaaatatgtccatttaaatagggagggaaagatATGAAATCACAAAACGAAGTTTGTATTGTT
TGTGAGACAGAAAGAAAAGAAGGGATATATGTTTATAATAATTTAATATGTTATGAAT
GTGAAAAGGACATGGTGAATACGGAAACAGATGATCCGAAGTATATATATTATTTAAA
ACAACTTCGAAAATTAGAAGTATCATATTTTTAAataggcatatgcctattatttttttgttctgtataatagat
aaagaatgaaataataaggaagagatatagATG

    BAS0028 --- BAS0029 --- BAS0030 --- BAS0031 --- BAS0032 Gene: BAS0028     GI: 49183063     BI number: BAS0028     GOG: COG1982     Description: lysine decarboxylase Gene: BAS0029     GI: 49183064     BI number: BAS0029     GOG: COG0125     Description: thymidylate kinase Gene: BAS0030     GI: 49183065     BI number: BAS0030     GOG: COG0470     Description: DNA polymerase III, delta prime subunit Gene: BAS0031     GI: 49183066     BI number: BAS0031     GOG: COG1774     Description: conserved hypothetical protein Gene: BAS0032     GI: 49183067     BI number: BAS0032     GOG: COG4467     Description: conserved hypothetical protei            AA           A  T           A  T           G  A            CG            TA            TA            CG            AT           |  A           |  T           |  C           |  A           |  T           A  A           C  T   A        AT T  T       AT T  T       AT A  T       AT T  A       TA A  A       TA T  A       Ta A  A       At        ta T  C       Ta       a  t A  A       Tg        cg TA       |  g       gc GC       A  c       gc AT        Ta        at AT        At        ta GC        Ta        at CG        At        At                         atttttttgttctgtataatagataaagaatgaaataataaggaagagatatagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1982 Arginine/lysine/ornithine decarboxylases ... can be seen here [F] COG0125 Thymidylate kinase ... can be seen here [L] COG0470 ATPase involved in DNA replication ... can be seen here [S] COG1774 Uncharacterized homolog of PSP1 ... can be seen here [S] COG4467 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................