                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:33 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=52 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACGGTGCTTCTGAAGTATATGCTTGCTGTACACACCCAGTATTATCTGGTCCAGCAA
TTGAGCGTATCCAAAACTCAAATATTAAAGAGTTAGTTGTAACGAACTCTATCGTATT
ACCAGAAGAGAAGAAAATTGACAAAGTACATGAACTTTCAGTTGCTCCACTAATCGGA
GAAGCAATCATTCGTGTATACGAAGAAGAATCTGTAAGTGTATTATTCAATTAAttggat
agaatgagacgtaaccaagattggttacgtcttttcgtatcgaaaaaagaaagtagtggtacaagaATG

    BAS0050 Gene: BAS0050     GI: 49183085     BI number: BAS0050     GOG: COG0193     Description: peptidyl-tRNA hydrolas             t           A  t           A  g            Tg            Ta            At           A  a            Cg            Ta            Ta            At            Tg GA        Ta A  A      A  g AT        Ta GC        Gc AT        Tg |  G      |  t       ga |  T      G  a      a  t A  A      A  a       at G  A      A  c       cg CG       T  c       cg AT       G  a       at TG        Ta        at AT        Cg        ta TA        Ta        gc GT        At        cg                         tcttttcgtatcgaaaaaagaaagtagtggtacaagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0193 Peptidyl-tRNA hydrolase ... can be seen here     ..................................................................................................................