                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:66 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -7.60 kcal/mol
Antiterminator: Size=78 nt.     Delta G= -6.81 kcal/mol
Anti-antiterminator:   Size=67 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGAGTAATGTAGGCTCCGTTACCGCAGAAAAAGTATATAGCGACGTTTTATTTCAAC
TAACAGAGCAAGAAGTAGTAGAGATGATTCATTTTCATGAGAATGGAAATATATATAT
AAAAACGATTTGTGAATTATGTCAAGAAACGCTCGCATCTTATCCTGAGTATTATGAA
TATGAAAAATTTCTGCAATAAaatgttgtcgctttggcgtgtccaaagcatttttctgttttctttttccaaaatatttgcataa
aatatagtggcttgctctttatgttgagaggggttttgaaaATG

    BAS0052 Gene: BAS0052     GI: 49183087     BI number: BAS0052     GOG: COG1197     Description: transcription-repair coupling facto             g           c  c           t  t           g  t TT       t  t C  A      t  g T  T      g  g A  C      t  c C  C      a  g GT       a  t CG        Ag TA        A CG        T G  T      | C  A      A AT       A AT       C A  A       G G  |       T A  |       C AT        T CG       T |  A       T TA        A GT        A TA        A AT       A  | TG       A  | TA       G  | |  A       T |  A       A |  A       T |  A      A          t |  T      A        g  g AT        G       c  t AT        T        gc GC       |         gc |  T       A        ta TG        T        ta GC        T        ta TA        A        cg TA        T        gc                         atttttctgttttctttttccaaaatatttgcataaaatatagtggcttgctctttatgttgagaggggttttgaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [LK] COG1197 Transcription-repair coupling factor (superfamily II helicase) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_str_Sterne                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -7.60 kcal/mol Antiterminator: Size=78 nt.     Delta G= -6.81 kcal/mol Anti-antiterminator:   Size=67 nt.     Delta G= -5.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GGGAGTAATGTAGGCTCCGTTACCGCAGAAAAAGTATATAGCGACGTTTTATTTCAAC TAACAGAGCAAGAAGTAGTAGAGATGATTCATTTTCATGAGAATGGAAATATATATAT AAAAACGATTTGTGAATTATGTCAAGAAACGCTCGCATCTTATCCTGAGTATTATGAA TATGAAAAATTTCTGCAATAAaatgttgtcgctttggcgtgtccaaagcatttttctgttttctttttccaaaatatttgcataa aatatagtggcttgctctttatgttgagaggggttttgaaaATG     BAS0052 Gene: BAS0052     GI: 49183087     BI number: BAS0052     GOG: COG1197     Description: transcription-repair coupling facto             g           c  c           t  t           g  t AT       t  t T  G      t  g T  A      g  g A  A      t  c T  T      a  g GA       a  t AT        Ag GG        A TA        T C  A      | C  A      A TA       A AA       C T  T       G T  |       T C  |       C TT        T AT       T |  C       T CT        A GG        A CC        A TA       A  | CA       A  | GT       G  | |  A       T |  A       A |  a       T |  a      A          t |  t      A        g  g Cg        G       c  t A        T        gc A       |         gc |         A        ta A        T        ta G        T        ta A        A        cg A        T        gc                         atttttctgttttctttttccaaaatatttgcataaaatatagtggcttgctctttatgttgagaggggttttgaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [LK] COG1197 Transcription-repair coupling factor (superfamily II helicase) ... can be seen here     ..................................................................................................................