Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:116 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -9.40 kcal/mol
Antiterminator: Size=71 nt.     Delta G=-11.50 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATAAGCGAAATAGAGCACAAAGCGGTCAATACTGCTGCCAGTTTCTTAGCGAAACAA
ATGGAACAGTAAaggtgtgtaattttagaagtagcaatctttcctaattatgatatttcttcttgagaaatcaattatttggagatatatg
tatattgaatgaaggtagcgctttgctaccttttttcattgaatatttctagcgttgcacgaacgtattcttacttgtgtaggtgagtaagcttgtcctt
ttctttatgatataatacgaggggtgagaatagaaaaaggagttttcttgtATG

    BAS0054 --- BAS0055 --- BAS0056


Gene: BAS0054     GI: 49183089     BI number: BAS0054     GOG: COG2244     Description: stage V sporulation protein B, putative
Gene: BAS0055     GI: 49183090     BI number: BAS0055     GOG: COG3956     Description: tetrapyrrole methylase family protein/MazG family protein
Gene: BAS0056     GI: 49183091     BI number: BAS0056     GOG: COG1188     Description: S4 domain protei


           aa
          g  a
           at
           gc
           ta
           ta
          |  t
          |  t
          |  a
          |  t
          |  t
          |  t
           cg
           tg
           ta
  c        cg
g  a       ta
a  a      t  t
t  t       ta
 gc        at
 at        ta
 at        at
 gt       |  g
a  c       gt
t  c       ta
t  t       at
 ta        ta
 ta       t  t
 at       a  t
 at       a  g        t
 ta       t  a      c  t
 gt       c  a      g  t
|  g      c  t       cg
 ta        tg        gc
 gt        ta        at
 ta        ta        ta
 gt        cg        gc
 gt        tg        gc
 at        at        at
                        tttttcattgaatatttctagcgttgcacgaacgtattcttacttgtgtaggtgagtaagcttgtccttttctttatgatataatacgaggggtgagaatagaaaaaggagttttcttgtATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG2244 Membrane protein involved in the export of O-antigen and teichoic acid ... can be seen here
[R] COG3956 Protein containing tetrapyrrole methyltransferase domain and MazG-like (predicted pyrophosphatase) domain ... can be seen here
[J] COG1188 Ribosome-associated heat shock protein implicated in the recycling of the 50S subunit (S4 paralog) ... can be seen here

    ..................................................................................................................