                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:48 nt.    Distance to gene:172 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-20.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTTA-GAACGT. It has a score value of 62.92 and is shown in blue

TTGTTATTATCCCAAGTAATGGTGAACGTTATTTAAGTACACCACTTTATCAATTTGA
GTCTTAAttacatgtgattgaaaaagcatccttgaaaaaggatgctttttctttttggattggaaataggaaaagagtgaatgactagaaaactt
catgtaaaataagaggtagtatcattaatttattttcactagccttcgaatataacccttctatatacataacgaatgtagcttgaagtggttaatataa
gagggtgggataaaagaagacggggtgttgatATG

    BAS0068 --- BAS0069 --- BAS0070 --- BAS0071 --- BAS0072 --- BAS0073 --- BAS0074 Gene: BAS0068     GI: 49183103     BI number: BAS0068     GOG: COG0147     Description: para-aminobenzoate synthase, component I Gene: BAS0069     GI: 49183104     BI number: BAS0069     GOG: COG0512     Description: para-aminobenzoate synthase glutamine amidotransferase, component II Gene: BAS0070     GI: 49183105     BI number: BAS0070     GOG: COG0115     Description: 4-amino-4-deoxychorismate lyase PabC Gene: BAS0071     GI: 49183106     BI number: BAS0071     GOG: COG0294     Description: dihydropteroate synthase Gene: BAS0072     GI: 49183107     BI number: BAS0072     GOG: COG1539     Description: dihydroneopterin aldolase Gene: BAS0073     GI: 49183108     BI number: BAS0073     GOG: COG0801     Description: 2-amino-4-hydroxy-6- hydroxymethyldihydropteridine pyrophosphokinase Gene: BAS0074     GI: 49183109     BI number: BAS0074     GOG: COG1396     Description: DNA-binding protei           aa          g  a           ta           ta           cg           cg           ta           at           cg           gc           at           at           at           at           at           gc             tttttggattggaaataggaaaagagtgaatgactagaaaacttcatgtaaaataagaggtagtatcattaatttattttcactagccttcgaatataacccttctatatacataacgaatgtagcttgaagtggttaatataagagggtgggataaaagaagacggggtgttgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EH] COG0147 Anthranilate/para-aminobenzoate synthases component I ... can be seen here [EH] COG0512 Anthranilate/para-aminobenzoate synthases component II ... can be seen here [EH] COG0115 Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase ... can be seen here [H] COG0294 Dihydropteroate synthase and related enzymes ... can be seen here [H] COG1539 Dihydroneopterin aldolase ... can be seen here [H] COG0801 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase ... can be seen here [K] COG1396 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_str_Sterne                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:55 nt.    Distance to gene:179 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -9.20 kcal/mol Antiterminator:    Distance from promoter:16 nt. Size=44 nt.     Delta G= -4.00 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGTTA-GAACGT. It has a score value of 62.92 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGTTATTATCCCAAGTAATGGTGAACGTTATTTAAGTACACCACTTTATCAATTTGA GTCTTAAttacatgtgattgaaaaagcatccttgaaaaaggatgctttttctttttggattggaaataggaaaagagtgaatgactagaaaactt catgtaaaataagaggtagtatcattaatttattttcactagccttcgaatataacccttctatatacataacgaatgtagcttgaagtggttaatataa gagggtgggataaaagaagacggggtgttgatATG     BAS0068 --- BAS0069 --- BAS0070 --- BAS0071 --- BAS0072 --- BAS0073 --- BAS0074 Gene: BAS0068     GI: 49183103     BI number: BAS0068     GOG: COG0147     Description: para-aminobenzoate synthase, component I Gene: BAS0069     GI: 49183104     BI number: BAS0069     GOG: COG0512     Description: para-aminobenzoate synthase glutamine amidotransferase, component II Gene: BAS0070     GI: 49183105     BI number: BAS0070     GOG: COG0115     Description: 4-amino-4-deoxychorismate lyase PabC Gene: BAS0071     GI: 49183106     BI number: BAS0071     GOG: COG0294     Description: dihydropteroate synthase Gene: BAS0072     GI: 49183107     BI number: BAS0072     GOG: COG1539     Description: dihydroneopterin aldolase Gene: BAS0073     GI: 49183108     BI number: BAS0073     GOG: COG0801     Description: 2-amino-4-hydroxy-6- hydroxymethyldihydropteridine pyrophosphokinase Gene: BAS0074     GI: 49183109     BI number: BAS0074     GOG: COG1396     Description: DNA-binding protei tt A  a Ac Ta Tt Cg Tt Gg Aa |  t G  t T  g T  a T  a Aa        aa Aa       g  a |  a       ta C  g       ta T  c       cg Aa        cg Tt        ta Tc        at Tc        cg             ctttttctttttggattggaaataggaaaagagtgaatgactagaaaacttcatgtaaaataagaggtagtatcattaatttattttcactagccttcgaatataacccttctatatacataacgaatgtagcttgaagtggttaatataagagggtgggataaaagaagacggggtgttgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EH] COG0147 Anthranilate/para-aminobenzoate synthases component I ... can be seen here [EH] COG0512 Anthranilate/para-aminobenzoate synthases component II ... can be seen here [EH] COG0115 Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase ... can be seen here [H] COG0294 Dihydropteroate synthase and related enzymes ... can be seen here [H] COG1539 Dihydroneopterin aldolase ... can be seen here [H] COG0801 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase ... can be seen here [K] COG1396 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................