                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:66 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-14.40 kcal/mol
Antiterminator: Size=68 nt.     Delta G=-12.40 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGCTTTTGTTAGAAGCTCATAGAAGTGCGAAGCAGAGTTGTTTCCTTGGTACAGATG
ATGCAAGTCTCGTAGAACGTATCGGGAAGCAAGTAGGTGTAGTAGAGGGGAGTTACTA
TAATATTAAAGTGACGACCCCAGAGGATTTACTAATTGCTGAAAGTTTTCTTCACGTT
CAAAAGAAATGAtagcaatgattatagcgaagaaaagctcggcaacggccgggcttttctttataaggatagcgatataatatagaatcat
aaagctcagtagtttagctcgaggaggatgtaaaaATG

    BAS0086 Gene: BAS0086     GI: 49183120     BI number: BAS0086     GOG: COG0245     Description: 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthas             a           c  a           g  t           a  g            ta            At            Gt            Ta            At           A  |           A  |           G  |           A  |           A  |           A  |           A  |           C  |            Ta            Tg   T        Gc G  T      C  | C  C      A  | A  A       Cg C  A       Ta TA        Ta TA        Cg CG        Ta TA        Ta TA        Ta TA        Ta        ac T  T      G  g      a  g G  G      A  c       cg A  A      A  |       gc A  |       At        gc A  |       Gc        cg Gt        Tg        tg Ta        Cg        cg Cg        Gc        gc Gc        Ta        at Ta        Ta        at                         ttctttataaggatagcgatataatatagaatcataaagctcagtagtttagctcgaggaggatgtaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0245 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase ... can be seen here     ..................................................................................................................