                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:168 nt.    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-13.90 kcal/mol
Antiterminator:    Distance from promoter:115 nt. Size=74 nt.     Delta G= -4.32 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCGA-AACAAT. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCGACTTCTGATTATACGGAACAATGGGTTATATTTGCTCAAGGTGCGCTCCGGAA
ATCTGCACGGGAATTAGAGCTGGAAGTACAAGCGATGGAGCAACAAGTAAGAAGGCGT
ACACAAGACACAAAAGAAAAGCAACCTGCTATGCGAAAGATATTTAGTAAAGATATTA
CAGAAAAGTTAGAAAAATTAAGAAGAGGAGAGCGTTGAagcattgacgctctttgtctttttactgtataat
atttctaaataaatagcggtcggagggatcaagGTG

    BAS0093 Gene: BAS0093     GI: 49183127     BI number: BAS0093     GOG: COG1595     Description: RNA polymerase sigma-30 facto AA G  A A  A CG AT T  T T  A A  G T  A A  A G  A A  A A  | A  | TA GT AT TA TA TG |  A A  A       gc T  G      a  a A  A       At G  G       Gt A  G       Tg A  A       Ta A  G       Gc G  A       Cg CG        Gc GC        At TG        Gc AT        At |  T       Gt |  G       Gt |  A      A  g Ta       G  | Cg       A  | Gc        At Ta        Gc             tttttactgtataatatttctaaataaatagcggtcggagggatcaagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1595 DNA-directed RNA polymerase specialized sigma subunit, sigma24 homolog ... can be seen here     ..................................................................................................................