                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:121 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-16.70 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTGATAAAGTACGCGAAATCGCTGAAACTAAAATGCCTGACCTAAACGCTGCTAGCG
TAGAAGCTGCAATGCGTATGGTTGAAGGTACTGCACGCAGTATGGGCATCGTTATCGA
AGACTAAttcgatttgttttttaaaaaaggttgcgggtctggaattccaattcgcaacctttattatcgtaaatgattatcgtttttaaataaat
ggatggcgcgcatcctcaggttatacctgaaaataagcgtaaacgtgggaggttattccgctaaaaccacattcgaggaggaaataaaaATG

    BAS0098 Gene: BAS0098     GI: 49183132     BI number: BAS0098     GOG: COG0081     Description: ribosomal protein L            tt           t  a            ta            ta            ta           g  a CT        ta A  A       tg G  A       tg At        at        at At        gt       a  t Gc        cg        gc Cg       t  c       gc Ta       t  g       ta At       A  |      c  | T  t      A  |       ta T  |       Tg        gt G  |       Cg        gt C  |       At        gc T  |       Gc        cg At        At        gc Cg       A  g       ta Gt       G  |       ta Gt        Cg        gc Gt        Ta        gc                         tttattatcgtaaatgattatcgtttttaaataaatggatggcgcgcatcctcaggttatacctgaaaataagcgtaaacgtgggaggttattccgctaaaaccacattcgaggaggaaataaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0081 Ribosomal protein L1 ... can be seen here     ..................................................................................................................