                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:141 nt.    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-12.80 kcal/mol
Antiterminator:    Distance from promoter:95 nt. Size=55 nt.     Delta G=-14.54 kcal/mol
Anti-antiterminator:    Distance from promoter:61 nt.    Size=52 nt.     Delta G= -6.76 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGAAA-TAAAAG. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGAAATCACTGGTCTTGGCTTAAAAGAAGCTAAAGAATTAGTTGACAACACTCCAAA
AGTAATCAAAGAAGCTGCTGCTAAAGAAGAAGCTGAAGAAATCAAAGCTAAACTTGAA
GAAGTTGGCGCTGCTGTAGAAGTTAAGTAAttaacttttgatgctttaaaaaaagctcgctctcatgcgagctttttt
taactgtaaagaaaagaggtggccatATG

    BAS0101 Gene: BAS0101     GI: 49183135     BI number: BAS0101     GOG: COG2813     Description: ybxB protei            TA           G  A            At            At            Ta            Ta            Gc AA        At G  G       At TA        Gt TA        At CG        Tg A  |      |  a AT       |  t AT       |  g TG       |  c CG       |  t GC       |  t A  G      |  t A  C      |  a AT       |  a CG       |  a T  C      |  a A  T      |  a       tc A  G      G  a      c  a A  T       Ta       t  t G  A       Cg        cg A  G       Gc        gc A  A      T  t       cg G  |      C  |       ta TA        Gc        cg CG        Cg        gc GT        Gc        at AT        Gt        at                         tttttaactgtaaagaaaagaggtggccatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG2813 16S RNA G1207 methylase RsmC ... can be seen here     ..................................................................................................................