                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:137 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -3.06 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -4.89 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACGTTGAcggttatttttggctatgttaacattatacaatgccaatatatgattttctgcgttgagaaagatgtatatttttgtttctcttgg
aaaagatagtaaaatcagcagattatgaaacagaatgatggttttcttatagaagccatttttcttttttgagcaggtagaaagactcaacgtatttatc
tttaagagaaaaaagactacgctaaatagcagtagttgtatttatttgtgattttgcacaaattttttgtgcatttataatactcatgatttgaggggtg
aagcagTTG

    BAS0102 --- BAS0103 Gene: BAS0102     GI: 49183136     BI number: BAS0102     GOG: COG0085     Description: DNA-directed RNA polymerase, beta subunit Gene: BAS0103     GI: 49183137     BI number: BAS0103     GOG: COG0086     Description: DNA-directed RNA polymerase, beta' subuni ct t  t cg tg ta t  | g  | ta ta         a ta       g  a tg       t  a ta       a  c at       t  a       ta ta       t  g      t  t a  g      a  a      c  a t  t      g  a       tg g  a       at        ta t  a       cg        ta a  a      g  a       tg g  a       at        gc a  |       cg        gc a  |       tg        ta a  |       at        at g  |       at        gt at        at       t  t gc        at        at ta       t  |       at tg        gc        gc gc        at        at                         tttttgagcaggtagaaagactcaacgtatttatctttaagagaaaaaagactacgctaaatagcagtagttgtatttatttgtgattttgcacaaattttttgtgcatttataatactcatgatttgaggggtgaagcagTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0085 DNA-directed RNA polymerase, beta subunit/140 kD subunit ... can be seen here [K] COG0086 DNA-directed RNA polymerase, beta' subunit/160 kD subunit ... can be seen here     ..................................................................................................................