                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:107 nt.    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-14.20 kcal/mol
Antiterminator:    Distance from promoter:87 nt. Size=27 nt.     Delta G= -5.20 kcal/mol
Anti-antiterminator:    Distance from promoter:67 nt.    Size=26 nt.     Delta G=-10.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCCA-TCGAAT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCCAAGGTTGGGGTCGCGGGTTCGAATCCCGTCTTCCGCTTAAttactaaGGGGCCTTA
GCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGTCAGCGGTTCGATCCCGCTAG
GCTCCATCTaatagagaaagcttacatcatatgatgtaagcttttttgtgtttaaaaagacaactttcatacttgtcatttaaaatggagaaaa
cgtgaaaataaaggatggagatagttATG

    BAS0153 --- BAS0154 Gene: BAS0153     GI: 49183186     BI number: BAS0153     GOG: -------     Description: glycerate kinase, N-terminus Gene: BAS0154     GI: 49183187     BI number: BAS0154     GOG: COG1929     Description: glycerate kinase C-terminu   G         a C  A      a  t       ta T  T      T  a      a  t T  C       Cg        cg GC        Ta        ta GC       A  g       at CG       C  a       cg GC       C  a       at AT        Ta        ta |  A       Cg        ta CG        Gc        cg TG        Gt        gc GC        At        at GT        Ta        at                         ttttgtgtttaaaaagacaactttcatacttgtcatttaaaatggagaaaacgtgaaaataaaggatggagatagttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1929 Glycerate kinase ... can be seen here     ..................................................................................................................