Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:169 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-17.20 kcal/mol
Antiterminator: Size=61 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtgcgatgctttatctctttaatcaaagaattgtaaataagctatgatcaaacttttttataaaacataagcatacacctgttggataagaaaccatttt
gattagactttttcaaaatggtttctttttattcatcatagaatacggtttaacacaatatttttaatcaaactttattttaaagccacacattgctttt
tcttatggtgaatttgtttcttagttatttcctgcattttatatcgttcaccaatcatgtaatgttaagggagatgacaaaagaaaggaagaatgtacaa
ATG

    BAS0161


Gene: BAS0161     GI: 49183194     BI number: BAS0161     GOG: COG0596     Description: conserved hypothetical protei


 at
c  a
g  c
a  a
a  c
t  c
 at
 cg
 at
 at
a  g
a  g
 ta        ac
 at       g  t
 ta       a  t
 ta       t  t
 tg       t  t
 ta        at
 ta        gc
 ta        ta
|  c       ta
|  c       ta
|  a       ta
c  t       at
 at        cg
 at        cg
 at        at
 cg        at
 ta        at
 at        gc
 gt        at
 ta        at
            tttattcatcatagaatacggtttaacacaatatttttaatcaaactttattttaaagccacacattgctttttcttatggtgaatttgtttcttagttatttcctgcattttatatcgttcaccaatcatgtaatgttaagggagatgacaaaagaaaggaagaatgtacaaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG0596 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) ... can be seen here

    ..................................................................................................................