                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:131 nt.    Distance to gene:77 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-18.80 kcal/mol
Antiterminator:    Distance from promoter:103 nt. Size=45 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:    Distance from promoter:67 nt.    Size=54 nt.     Delta G=-10.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tcgaaa-taaaat. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcgaaatatacaatttgaaccaaataataaaatagcaatttacttatccagagaggtagagggactggccctatgacacctcagcagcgggttctgtaat
aggaacaccgtgctaattccagcaagcaagtcttgaaagataagtgatgggcctttgtttattaagccttgatcttattttttaggatcaaggctttttg
tattctaaaaagagaaaagggagtaatggaaaaagtacgttcataaaacaaagtaaattcatgtgtttagggggttATG

    BAS0186 --- BAS0187 --- BAS0188 --- BAS0189 --- BAS0190 Gene: BAS0186     GI: 49183219     BI number: BAS0186     GOG: COG0601     Description: oligopeptide ABC transporter, permease protein Gene: BAS0187     GI: 49183220     BI number: BAS0187     GOG: COG1173     Description: oligopeptide ABC transporter, permease protein Gene: BAS0188     GI: 49183221     BI number: BAS0188     GOG: COG0444     Description: oligopeptide ABC transporter, ATP-binding protein Gene: BAS0189     GI: 49183222     BI number: BAS0189     GOG: COG4608     Description: oligopeptide ABC transporter, ATP-binding protein Gene: BAS0190     GI: 49183223     BI number: BAS0190     GOG: COG4166     Description: oligopeptide ABC transporter, oligopeptide-binding protei   a a  g c  t gc at at cg g  a       tt a  a      t  a c  a      g  t cg       t  t ta        ta t  t       ta a  a      c  | a  |       cg         t ta        gc       t  t cg        gc       t  t gt        gt        at |  g      t  t       ta ta       a  g       tg gt       g  a       cg cg       t  t       ta cg        gc        at a  g       at        gc c  |       at        ta a  |       ta        ta a  |       at        cg gc        gt        cg gc        at        gc at        at        at                         ttttgtattctaaaaagagaaaagggagtaatggaaaaagtacgttcataaaacaaagtaaattcatgtgtttagggggttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG0444 ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component ... can be seen here [E] COG4608 ABC-type oligopeptide transport system, ATPase component ... can be seen here [E] COG4166 ABC-type oligopeptide transport system, periplasmic component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................