                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:104 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.90 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-10.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGCGGCGGATATACTGGTAAAAATAAAGAAGTTTTATATGTGGTTATTAATAAACAA
GAGCTTGTTAAGTTAAAGCAAGTTATTAGCCGAGTGGATGAAGATGCTTTCGTCGTTA
TCCATGATGTACGTGATGTACTTGGCGGTGGCTTTAAAGCAAGCTAAaaggtgaacgaataaatt
cgttcaccttttttattcttacaaaaatgtaagtgtaatgtaatgagattcaatagtagattttattccttctttttaaaatggatgtatatatatcctg
cagaggaggaatgtttattATG

    BAS0211 Gene: BAS0211     GI: 49183244     BI number: BAS0211     GOG: COG5294     Description: conserved hypothetical protei   G T  T A  A GC TG AT C  |       AA CG       A  G TA       T  C AT        TA TG        TA        aa |  T       CG       t  a |  A       GC        at |  C       GT        at T  T       TA        gc GT       G  A       cg CG       G  a       at TG       C  |       at GC       G  |       gc CG       G  |       ta TG        Ta        gc T  T       Tg        gc TG        Cg        at CG        At        at GC        Tg        At                         tttattcttacaaaaatgtaagtgtaatgtaatgagattcaatagtagattttattccttctttttaaaatggatgtatatatatcctgcagaggaggaatgtttattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5294 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................