Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:158 nt.    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcat-aaaaat. It has a score value of 64.93 and is shown in blue

ttgcataataagtacaaatagataaaaataattagggatatagtaagaagggagaagaatgggatgcgtaaagaagaagtagtgaagtttccaattaaag
atttctgtagctactttactgttgccgtagtatgtattggattatttgatatcataacaaacttaattgttaaataatatagatgacaaaacaagaaggg
agatcctttcttgttttttttatgggggaataaagATG

    BAS0212


Gene: BAS0212     GI: 49183245     BI number: BAS0212     GOG: COG0084     Description: deoxyribonuclease, TatD family, putativ


          ga
         a  t
          gc
          gc
          gt
          at
          at
          gc
          at
          at
          cg
          at
          at
          at
          at
            ttttatgggggaataaagATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG0084 Mg-dependent DNase ... can be seen here

    ..................................................................................................................