                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:164 nt.    Distance to gene:21 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.40 kcal/mol
Antiterminator:    Distance from promoter:150 nt. Size=26 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:    Distance from promoter:120 nt.    Size=40 nt.     Delta G=-18.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTAGC-TAGATT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAGCTGCACGTGCCAAATTTTTAGATTTTATCTATTTTTGTCGTGCGATTTTTCAT
GATGTAGTTGTTAACGGGATACGTCTGTCCTTTTTTAACAATTGCATAGTAGCTATAG
AACGATAGaaatctcttcacccatttttaatacacgtgtgaaaagggagctatttagcttcctttttctatgtcgaaaaccatggggaatgttt
ctttcccatggttttttatattgaaaggagtacggaaaATG

    BAS0217 Gene: BAS0217     GI: 49183250     BI number: BAS0217     GOG: COG0488     Description: ABC transporter, ATP-binding protei tt a  t ta cg gc at                  tt gt                 g  t gc        aa       t  c gc       g  a       at at       c  a       at at       t  c       gt at        gc        gc at        ta        gc gt        at        gc t  c       tg        ta gt        cg        at ta       t  g       cg gt       t  g       cg cg        ta        at at        ta        at                         ttttatattgaaaggagtacggaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0488 ATPase components of ABC transporters with duplicated ATPase domains ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_str_Sterne                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:130 nt.    Distance to gene:65 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-10.20 kcal/mol Antiterminator:    Distance from promoter:92 nt. Size=47 nt.     Delta G= -6.43 kcal/mol Anti-antiterminator:    Distance from promoter:52 nt.    Size=44 nt.     Delta G= -5.00 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTTAGC-TAGATT. It has a score value of 65.6 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTTAGCTGCACGTGCCAAATTTTTAGATTTTATCTATTTTTGTCGTGCGATTTTTCAT GATGTAGTTGTTAACGGGATACGTCTGTCCTTTTTTAACAATTGCATAGTAGCTATAG AACGATAGaaatctcttcacccatttttaatacacgtgtgaaaagggagctatttagcttcctttttctatgtcgaaaaccatggggaatgttt ctttcccatggttttttatattgaaaggagtacggaaaATG     BAS0217 Gene: BAS0217     GI: 49183250     BI number: BAS0217     GOG: COG0488     Description: ABC transporter, ATP-binding protei             a AG       t  a T  T      t  t A  A      t  a CG       t  c GC       t  a T  T      a  c T  A      c  g A  T      c  t A  |       cg C  |       at A  |       cg A  |       ta T  |      |  a T  |      |  a TA        ta TG        cg        tt TA        tg       a  t TA        cg        ta C  C       ta        cg CG       a  g       gc TA       a  |       at GT       a  |       gt TA        Gc        gc CG        At        gc Ta        Ta        at                         ttttctatgtcgaaaaccatggggaatgtttctttcccatggttttttatattgaaaggagtacggaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0488 ATPase components of ABC transporters with duplicated ATPase domains ... can be seen here     ..................................................................................................................