                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:87 nt.    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-15.40 kcal/mol
Antiterminator:    Distance from promoter:53 nt. Size=45 nt.     Delta G= -5.70 kcal/mol
Anti-antiterminator:    Distance from promoter:18 nt.    Size=51 nt.     Delta G=-10.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTAACG-TAGAAT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAACGTGGTCGCATAACGGAGTAGAATATATGCTCGTGTCTAAAGGTTTAGAGCCGA
AGGAGCTATTAATGGTTGCTCGTTCAGTTACAGAGAAGCAAGTGAAGTAAacttcttagacgt
ggtgatatatgtgcaccacgtcttttcttagtttgaagggtggatttcataaaagaagcatataaaagaataagcttcgcatatcgtgtataaggaagtg
tatttATG

    BAS0238 Gene: BAS0238     GI: 49183271     BI number: BAS0238     GOG: COG0787     Description: alanine racemas   A A  T T  G T  G A  T        G T  T      A  T CG       A  A GC       G  A AT        Ta GC        Gc G  G       At AT        At AT       C  | GC        Gc         a C  A       At       t  t CG        At       a  g GT       G  a      t  t AT       A  g      a  g |  A      G  a       gc |  C      A  c       ta |  A       Cg        gc |  G       At        gc G  A       Tg        ta A  G       Tg        gc TA       G  |       cg TA        At        at TG        Cg        gc GC        Ta        at                         tttcttagtttgaagggtggatttcataaaagaagcatataaaagaataagcttcgcatatcgtgtataaggaagtgtatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0787 Alanine racemase ... can be seen here     ..................................................................................................................